![]() Epub 2021 Feb 11.Īssembly and Function of a Bioengineered Human Liver for Transplantation Generated Solely from Induced Pluripotent Stem Cells. Yoshimatsu M, Ohnishi H, Zhao C, Hayashi Y, Kuwata F, Kaba S, Okuyama H, Kawai Y, Hiwatashi N, Kishimoto Y, Sakamoto T, Ikeya M, Omori K.Stem Cell Res. In vivo regeneration of rat laryngeal cartilage with mesenchymal stem cells derived from human induced pluripotent stem cells via neural crest cells. Lahr CA, Landgraf M, Wagner F, Cipitria A, Moreno-Jiménez I, Bas O, Schmutz B, Meinert C, Mashimo T, Miyasaka Y, Holzapfel BM, Shafiee A, McGovern JA, Hutmacher DW.īone. eCollection 2022 Mar. PMID: 35097166Ī humanised rat model reveals ultrastructural differences between bone and mineralised tumour tissue. Tada T, Ohnishi H, Yamamoto N, Kuwata F, Hayashi Y, Okuyama H, Morino T, Kasai Y, Kojima H, Omori K. Transplantation of a human induced pluripotent stem cell-derived airway epithelial cell sheet into the middle ear of rats. ![]() Optimal Organ for Patient-derived Xenograft Model in Pancreatic Cancer and Microenvironment that Contributes to Success.Įguchi S, Kimura K, Kageyama K, Tani N, Tanaka R, Nishio K, Shinkawa H, Ohira GO, Amano R, Tanaka S, Yamamoto A, Takemura S, Yashiro M, Kubo S.Īnticancer Res. Miyasaka Y, Wang J, Hattori K, Yamauchi Y, Hoshi M, Yoshimi K, Ishida S, Mashimo T. *Transgenic rats can be distinguished by PCR, electrophoresis and Sanger sequencing.Ī high-quality severe combined immunodeficiency (SCID) rat bioresource. It can be distinguished by the combination of NBRP Rat No.08. This strain shows severe combined immunodeficiency (SCID) caused by 5-bp deletion in Il2rg gene on the X chromosome and 1-bp insertion in Rag2 gene on chromosome 3.This strain grows normally under SPF condition. (Target) Rag2 (Product Size) Wilde type : 381bp, Mutant : 382bp, (Primer) GGGGAGAAGGTGTCTTACGG, AGGTGGGAGGTAGCAGGAAT This strain shows severe combined immunodeficiency (SCID) caused by 1-bp insertion in Rag2 gene on chromosome 3.This strain grows normally under SPF condition. (Target) Il2rg (Product Size) Wild Type : 292 bp, Mutant : 287 bp, (Primer) TTGCTGACTTCTATGGACCTTAAA, TTCATCTGGTCTGAACTGATAACTTAT ![]() This strain shows severe combined immunodeficiency (SCID) caused by 5-bp deletion in Il2rg gene on the X chromosome.This strain grows normally under SPF condition.
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |